circad | circRNAs associated with diseases

circ-0067934
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Non-small Cell Lung Cancer	ICD-10	Malignant neoplasm of bronchus and lung (C34)
DBLink	Link to database	PMID	30344708
Experimental Method
Sample Type	Tissue and cell lines	Comparison	79 NSCLC tissues and adjacent non-cancerous tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TAGCAGTTCCCCAATCCTTG Reverse CACAAATTCCCATCATTCCC	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Zou, Q, Wang, T, Li, B, Li, G, Zhang, L, Wang, B, Sun, S (2018). Overexpression of circ-0067934 is associated with increased cellular proliferation and the prognosis of non-small cell lung cancer. Oncol Lett, 16, 5:5551-5556.